xxaurorabluexx xxaurorabluexx

03-02-2019
Mathematics

contestada

Find the unknown angle

Find the unknown angle class=

Respuesta :

mrashrafkotkaat mrashrafkotkaat

03-02-2019

Answer:

Step-by-step explanation:

X=180_(90+41)=49

Answer Link

kimjooin02 kimjooin02

03-02-2019

Answer:

x = 49

Step-by-step explanation:

180 = 41 + 90 + x (90 bc it a rt angle btw)

180 = 131 + x

49 = x

Answer Link

Otras preguntas

If 938 employees of which 533 provide customer service what percentage supply sales support from that 938

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Good morning people, I hope all of you have a great day.

Find the value of n Also can you explain how you got it?

Someone actually please help me thank you

Explain what we mean when we say that a particular element has several isotopes.

please help, What is the nth term rule of the quadratic sequence below? -7,-6,-3,2,9,18,29

I NEED HELP. This is due in like 5 minutes

Read the conversation between a man and a woman. Choose the best word (a, b or c) for each space. For questions 41-50 mark A, B or C on your answer sheet. Shop

Farmer Jones has a problem with his field. Acid rain has made it too acidic. What type of substance should he add to neutralise the acid?