Karneysha
Karneysha Karneysha
  • 04-05-2016
  • Mathematics
contestada

This problem is very confusing.

This problem is very confusing class=

Respuesta :

CitrusCafe
CitrusCafe CitrusCafe
  • 04-05-2016
since 1/2 =2/4 = 4/8 = 5/10, only Mary drank less than half of her juice. 3/8 is less than 4/8
Answer Link
Аноним Аноним
  • 04-05-2016
Mary did because 3/8ths is smaller than 4/8ths
Answer Link

Otras preguntas

Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
testosterone directly affects the
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
why did russia have revolution in 1917?
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
the bombing of Hiroshima and Nagasaki resulted in
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea