nhy1 nhy1
  • 02-10-2019
  • Mathematics
contestada

What is 2.3 times 27

Respuesta :

kriggle62 kriggle62
  • 02-10-2019

Answer:

65.1

Step-by-step explanation:

Answer Link

Otras preguntas

There are 756 students in the elementary school. The cafeteria holds 92 students. What is the least number of lunch period needed to serve all of the students?
Can someone pls help me
Which statementbest supports the idea that some men returning from war will expect working women to give up their newly-acquired jobs when the war is over? A ".
es hora de comer es hora de comer
Fibers are directly made into what?
first come first served:):):)
Why do certain people – especially those in situations of adversity like Anna Cooper – succeed?
Erin works as a computer support person after school. She earns $15 per day plus $0.50 for each computer she fixes. Yesterday, Erin earned $16.50.
What's the weather like in Cancun during August? hace mucho soul (I know isn't right) Hace mucho frio. Hace buen tiempo Llueve mucho. PLEASE HURRY
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU