makenziekamel869 makenziekamel869
  • 02-03-2020
  • Mathematics
contestada

Solve for p: X = 3p+11, Y = 90°, and Z = 25°

Respuesta :

ryanw1273
ryanw1273 ryanw1273
  • 02-03-2020

Answer:

p = 18 degrees

Step-by-step explanation:

X = 3p + 11

Y = 90

Z = 25

We know that a triangle has a total of 180 degrees.

3p + 11 + 90 +25 = 180

3p + 126 = 180

3p = 180 -126

3p = 54

p  = 54/3

p = 18

Hope this helps!

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Compliant is to stubborn as excited is to
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Is 5/7 greater than 4/6
does a human body use neon???
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your