11017358 11017358
  • 02-04-2020
  • Mathematics
contestada

find the surface area of a hemisphere if the radius is 10.8

Respuesta :

Rosie
Rosie Rosie
  • 02-04-2020

Answer:

Surface Area = 732.8707 in²

Step-by-step explanation:

Surface Area = 2 x 3.1416 x 10.82

= 2 x 3.1416 x 116.64

Answer Link

Otras preguntas

The truman administration tried to help europe recover from the devastation of world war ii with the _____.
For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Solve for x. Assume that lines which appear tangent are tangent.
What type of plot structure allows authors to follow different characters through their own separate narratives, eventually converging, as the story is resolved
Tell what whole number you can substitute for x in the following list so the numbers are ordered from least to greatest. 2/x ,x/6, 70%
How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
A mixture from which some of the particles settle out slowly upon standing
Why did some americans feel that the united states should help europe after world war ii?
A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?