joecefalo7 joecefalo7
  • 02-02-2021
  • Biology
contestada

What do you think happens in places near the North and South Pole during the solstices?

Respuesta :

2021FOLLOWme
2021FOLLOWme 2021FOLLOWme
  • 02-02-2021

Answer:

The sun's vertical rays strike the Tropic of Cancer, 23.5° north of the Equator, during the June solstice. ... At the North Pole and South Pole, the solstices mark the time when the sun is highest or lowest in the sky. In this way, solstices are the extreme examples of “midnight sun” and “polar night.”

Explanation:

i hope it's help you"

Answer Link

Otras preguntas

Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
I want to work with LDAP. what is LDAP?
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
Step by step directions Square root for 480
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
who fought against each other in the crusades?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12