anaisalvarez055 anaisalvarez055

02-02-2021
Mathematics

contestada

Find the amount you save when you buy a $210 bicycle on sale for 15% off?

Respuesta :

02-02-2021

Answer:

you save $31.50 and the price now is $178.50

Step-by-step explanation:

Answer Link

VPVIPER VPVIPER

02-02-2021

Answer:The answer is 1400 plz give me brainliest

Step-by-step explanation: $210 divided by 15% is $1400 U.S dollars

Answer Link

Otras preguntas

It is illegal for a minor to even attempt to purchase alcohol. a. True b. False

stars and planets are made from gases in a

A string of lights contains three lights. the lights are wired in series, so that if any light fails the whole string will go dark. each light has probability .

In the adult, the internal reproductive organs and the urinary bladder are "housed" in which body cavity?

What’s the answer to #12? and why

Which is the best way to conserve worldwide freshwater resources? 1.increase the amount of land used to raise cattle 2.use more efficient irrigation technique

Hafsah is feeling upset lately. Which questions should Hafsah ask herself to determine whether she needs to seek professional mental health services? Check all

Questions 1–10: Identify each redundant expression. Some sentences contain no redundancies. 1. Weather conditions forced the regional managers to postpone thei

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

which of the following statements agrees with the second law of thermodynamics