s11114469 s11114469

02-03-2021
Mathematics

contestada

how much higher is -200 than 450m

Respuesta :

sadieasmith211 sadieasmith211

02-03-2021

Answer:

-200 isn't higher than 450 but 450 is:

450 is 250 higher than -200

Step-by-step explanation:

Answer Link

Otras preguntas

While the theme of "Ode on a Grecian Urn" focuses on how art is eternal, the theme of "Ozymandias" focuses on how a.royalty is superior. b.nature endures. c.thi

Which quotation from the text best supports the inference that the people of the sac nation do not typically challenge authority? "if he declared war he must le

The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is

The most famous trade route, the silk road, connected _____________ with _________ and ___________.

crystal lattice definition

Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What brings the u.s. into this war? - 1. economic factors (natural resources and new markets 2. nationalistic factors (competition to create an empire/prove you

If the points (-2, 2), (-4, 4), (2, -2), and (4, -4) are joined to form a straight line, at what point does the line intersect the y-axis

does mercury have a magnetic field