calebgooden7 calebgooden7

04-03-2021
Spanish

contestada

The verb GUSTAR
A John
me
A mi
gusta escribir.
montar bicicleta. Ole gusta
hablar mucho.
le gusta
le Ote
me gusta O) te gusta
nos gusta ) les gusta
A ellos

The verb GUSTAR A John me A mi gusta escribir montar bicicleta Ole gusta hablar mucho le gusta le Ote me gusta O te gusta nos gusta les gusta A ellos class=

Respuesta :

goldenxtaeh goldenxtaeh

04-03-2021

Answer:

ummm what is this

Explanation:

Answer Link

Otras preguntas

a ship sails 20km due north. It changes direction and then sails 15 due east. How far is it from its starting point?

what is x y and z value

List two types of chromosomal mutations.

answer both for ( brain list, thanks, 5 star review) PLS help

2x+5+3-4x please help me

Allie bought a bouquet of flowers and thought that there was 35 flowers in the bouquet but there was actually 52. What was her percent error rounded to the nea

Earth is the center of our solar system. Fact or Opinion

PLZ HELP solve plzs 560*921

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

I WILL MAKE YOU BRAINLIEST IF YOU ANSWER MY QUESTION AND I WILL GIVE YOU 36 POINTS Write a paragraph about something you have learned in your elective class.