Seudónimo Seudónimo
  • 03-04-2021
  • Business
contestada

Solve system graphically

Solve system graphically class=

Respuesta :

rylee12016
rylee12016 rylee12016
  • 03-04-2021
The answer is (x,y)=(-1,-1)
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which of the following is true about a writer’s diction? a.When the writer uses sophisticated vocabulary, the diction is informal. b.When the writer uses comple
What advice would you give someone whose life dream is to become a judge?
what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15
Write the equation of the line containing the point (1 2) and parallel to the line 2x + 4y = 1
Suppose that a particular artillery piece has a range r = 5710 yards . find its range in miles. use the facts that 1mile=5280ft and 3ft=1yard
Read each verbal expression Then assign a variable and distribute
i will mark as brainiest you answer this easy question
Which of the following excerpts from Fast Food Nation best provides evidence that fast food restaurants are designed for using unskilled labor? Her family’s mo
A guaranteed protection against vague laws is known as which of the following?