lovelexii1580 lovelexii1580

02-06-2021
Social Studies

contestada

Is it morally permissible to believe in God just because it is to your practical advantage to believe

Respuesta :

leximans37 leximans37

02-06-2021

Answer:

im not sure, I'd like to say no because just because it seems right, not everybody is going to have to same opinion on it. So i suppose my answer would be No, but i may be wrong

Answer Link

Otras preguntas

What Are Federalist's viewpoints on ratifying the constitution?

Use the multiplier method to decrease £262 by 39%You must show your working.

The inverse equation

TB MC Qu. 4-44 Privott, Inc., manufactures ... Privott, Inc., manufactures and sells two products: Product Z9 and Product N0. The company is considering adoptin

What was dust bowl in the 1920?

what is the meaning of tallow

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Using polynomial regression fit a cubic equation to the following data: x 3 4 5 7 8 9 11 12 y 1.6 3.6 4.4 3.4 2.2 2.8 3.8 4.6 Plot the data and the cubic equati

HELP!!! (x+3)²+8=72 (quadratic equation) Please explain why this equation has 2 solutions and solve for both. I really appreciate it!

y varies directly with x. If x=6 when y=30, determine y when x=8.