kitorr01033 kitorr01033
  • 01-03-2022
  • Mathematics
contestada

The values in this table represent a linear relationship between x and y. What is the rate of change with y with respect to x?
A. 10
B. 17
C. -10
D. -17

The values in this table represent a linear relationship between x and y What is the rate of change with y with respect to x A 10 B 17 C 10 D 17 class=

Respuesta :

puro42 puro42
  • 01-03-2022
The rate of change is -10
Answer Link

Otras preguntas

where are the three parts of an atom located
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
define concentric circles
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the geometric mean between 6 and 20?
why is the square root of a perfect square always rational
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
Please answer theses division problems!! 9 divided by 3/7
why did russia have revolution in 1917?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what