JacoveeDubs JacoveeDubs

01-04-2022
Mathematics

contestada

How many apples could you buy if you went to the store with five dollars?

Respuesta :

laneygames1 laneygames1

04-04-2022

Answer:5 apples

Step-by-step explanation:5x1=5

Answer Link

Otras preguntas

What is the solution to the equation ? n = −1 n = 2 n = 5/3 n = 5/2

Can someone please help me with numbers 1, a, b, c, 2, a, b, c

While Flinn was starting the fire, his friends were collecting firewood. Flinn has 5 sticks. If he puts 3 sticks in the fire every minute, and his friends bring

what is the answer to #16???? Helpppppp

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

if the volume of a triangular prism is 120 base l is is 6 and base h is is 5 what is the height

Helppppp how do u do this????

What is the value of x?

from what you have heard about modern war

Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa