hofchiiH7inky hofchiiH7inky
  • 04-02-2017
  • Health
contestada

It is proper to put away cups and knives after you have towel dried them

Respuesta :

andriansp andriansp
  • 12-09-2017
No, i don't think it's proper
The best method to dry cups and knives is by air drying them. Since you use most of this appliances to touch your foods, it is far more sanitary to let it air dry because you never know what kind of bacterias/other small organisms that currently cumulated in your towels
Answer Link

Otras preguntas

amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
how do you say theatre in Spanish
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
Tu as quels cours le jeudi matin?
in what area of Europe were the majority of warsaw pact countries
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
The Panama Canal connects what two bodies of water?
What was George Washington's nickname?