EmmaJ1121 EmmaJ1121
  • 03-04-2017
  • Biology
contestada

how does the process of hearing differ between a person who is awake and a person who is asleep?

Respuesta :

wm20swhiteman
wm20swhiteman wm20swhiteman
  • 03-04-2017
When a person is awake their brain is more alert and aware of it's surroundings. When a person is asleep their brain is slower at receiving and processing  the sound waves. 

Hope this helps!
Answer Link

Otras preguntas

as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
Please answer theses division problems!! 9 divided by 3/7
Help pl0x, Algebra 1
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
how would u form a superlative for the adverb widely
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do you put allele in a sentence
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Compliant is to stubborn as excited is to