O8ferkariazbozel O8ferkariazbozel
  • 02-05-2017
  • Social Studies
contestada

Sigmund freud proposed that his patients' disorders resulted most often from psychological conflicts related to ______________.

Respuesta :

jakeclauss17 jakeclauss17
  • 02-05-2017
He believed many disorders come from subconscious desire
Answer Link

Otras preguntas

Why do you think it is a good idea to soak wilted lettuce in cool water before serving it?
Which phrase best describes the New World Order?
how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x
zimmerman note definition
What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Latin prefix opposite of mini-
How did the Bataan Death March gets its name
Help plsssssssssssss
Determine the total time that must elapse until only 1/16 of an original sample of th-234 remains unchanged.