elisabanushi1 elisabanushi1

02-06-2017
English

contestada

Which of the following is a purpose for Whitman's use of repetition of words and sounds in the poem?

Respuesta :

Xzibition Xzibition

02-06-2017

Since you did not put up an answer choice, the purpose for Whitman's use of repetition of words and sounds is to underscore the theme for emphasis, and for emotional effect.

Answer Link

Otras preguntas

PLEASE HELP!!!!!!!!!!!!!!! Mongol conquests ranged from East Asia to Eastern Europe during the thirteenth and fourteenth centuries. This relatively short period

epistrophe literary definition

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following are solutions to the equation below? Check all that apply. 4x2 - 81 = 0 A. 9 B.-9/2 C.-2/9 D.-9 E.9/2 F.2/9

A _____ reaction is one that consists of two or more elementary reactions. a. simple b. complex c. single d. double

Sam is eating a Big Hamburger. The first bite was 20% of the Hamburger, the second bite was 20% of what is left and so every next bite is 20% of what is left. a

With increasing doses of any useful drug there is usually an increase in the number and severity of

What is the density of a liquid that has a volume of 20.0 ml and a mass of 330 grams?

A solution is select one: a. nonuniform. b. homogeneous. c. heterogeneous.

Who basically "began" England's religious reformation?