lizxthp lizxthp
  • 04-08-2017
  • Mathematics
contestada

how do you solve for the variable ?? help

how do you solve for the variable help class=

Respuesta :

Equanimity
Equanimity Equanimity
  • 04-08-2017
Hello there!

2(3x - 4) + 10 = 5(x + 4)
First, let's distribute 2 to 3x and -4, then 5 to x and 4.
2(3x) + 2(-4) + 10
6x - 8 + 10
6x + 2 is our first half of the equation simplified. Now let's do the other.

5(x + 4)
5(x) + 5(4)
5x + 20 is our second half of the equation simplified. Now let's put them back in their original spots.

6x + 2 = 5x + 20
Get x on one side - subtract 5x from both sides.
x  + 2 = 20
Isolate x by adding 8 to both sides.
x = 18 is our answer.

I hope this helps!
Answer Link

Otras preguntas

Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
Please help me with this two step math problem! THANK YOU !!!!!!!!
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Fossils are most commonly found in which type of rock?
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
Do all your pet's offspring look the same? If no, then explain why they look different.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Compliant is to stubborn as excited is to