Seudónimo Seudónimo
  • 04-04-2018
  • History
contestada

Oregon Should Not have been Part of The United States , Reasons - Arguments ?

Respuesta :

tnicholson01 tnicholson01
  • 13-04-2018
Really.  More of this Manifest Destiny!  Great Britian/Canada and USA sat down and peacefully talked where the lines should be drawn.  
Answer Link

Otras preguntas

Companies raise funds to expand their business by
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
what is the most common type of vegetation throughout Latin America
what is 0.00001267 is scientific notation